Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ATOH1_pUC18
(Plasmid #191250)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 191250 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC18
  • Backbone manufacturer
    Plasmid #50004
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATOH1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3631
  • Promoter lac promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAGAGCCCAAACATTCACACA
  • 3′ sequencing primer GCGGAGTTTCCTAAAAGACGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ATOH1_pUC18 was a gift from Chen Davidovich (Addgene plasmid # 191250 ; http://n2t.net/addgene:191250 ; RRID:Addgene_191250)
  • For your References section:

    PALI1 facilitates DNA and nucleosome binding by PRC2 and triggers an allosteric activation of catalysis. Zhang Q, Agius SC, Flanigan SF, Uckelmann M, Levina V, Owen BM, Davidovich C. Nat Commun. 2021 Jul 28;12(1):4592. doi: 10.1038/s41467-021-24866-3. 10.1038/s41467-021-24866-3 PubMed 34321472