pDEST_6xUAS:mNeonGreen-Rab5a
(Plasmid
#192355)
-
PurposezfRabaa tagged with mNeonGreen, expressed under the UAS promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneGateway Tol2 destination vector with cmlc2:mRFP-SV40pA for zebrafish red heart transgenesis marker
- Total vector size (bp) 7630
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab5a
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)651
-
GenBank ID337737
-
Entrez Generab5aa (a.k.a. fj38g08, hm:zehn1144, rab5a, wu:fj38g08)
-
Tag
/ Fusion Protein
- mNeonGreen (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gtctgaaacacaggccagat
- 3′ sequencing primer CCACATTTGTAGAGGTTTTACTTGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe Rab5aa cDNA was a gift from the Gilmour lab, originally published in Hartmann et al., 2020.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit for https://www.biorxiv.org/content/10.1101/2022.08.12.503784v1 bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST_6xUAS:mNeonGreen-Rab5a was a gift from Francesca Peri (Addgene plasmid # 192355 ; http://n2t.net/addgene:192355 ; RRID:Addgene_192355) -
For your References section:
A role for the centrosome in regulating the rate of neuronal efferocytosis by microglia in vivo. Moller K, Brambach M, Villani A, Gallo E, Gilmour D, Peri F. Elife. 2022 Nov 18;11:e82094. doi: 10.7554/eLife.82094. 10.7554/eLife.82094 PubMed 36398880