Skip to main content

pDEST_6xUAS:mNeonGreen-Rab5a
(Plasmid #192355)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192355 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Gateway Tol2 destination vector with cmlc2:mRFP-SV40pA for zebrafish red heart transgenesis marker
  • Total vector size (bp) 7630
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab5a
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    651
  • GenBank ID
    337737
  • Entrez Gene
    rab5aa (a.k.a. fj38g08, hm:zehn1144, rab5a, wu:fj38g08)
  • Tag / Fusion Protein
    • mNeonGreen (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gtctgaaacacaggccagat
  • 3′ sequencing primer CCACATTTGTAGAGGTTTTACTTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The Rab5aa cDNA was a gift from the Gilmour lab, originally published in Hartmann et al., 2020.

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST_6xUAS:mNeonGreen-Rab5a was a gift from Francesca Peri (Addgene plasmid # 192355 ; http://n2t.net/addgene:192355 ; RRID:Addgene_192355)
  • For your References section:

    A role for the centrosome in regulating the rate of neuronal efferocytosis by microglia in vivo. Moller K, Brambach M, Villani A, Gallo E, Gilmour D, Peri F. Elife. 2022 Nov 18;11:e82094. doi: 10.7554/eLife.82094. 10.7554/eLife.82094 PubMed 36398880