pDEST_6xUAS:Lamp1-mGFP
(Plasmid
#192356)
-
PurposeLamp1 tagged with mGFP, expressed under the UAS promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneGateway Tol2 destination vector with cmlc2:mRFP-SV40pA for zebrafish red heart transgenesis marker
- Total vector size (bp) 8540
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLamp1
-
Alt nameCD107a, LAMPA, LGP120
-
SpeciesH. sapiens (human)
-
GenBank ID3916
-
Entrez GeneLAMP1 (a.k.a. CD107a, LAMPA, LGP120)
-
Tag
/ Fusion Protein
- mGFP (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gtctgaaacacaggccagat
- 3′ sequencing primer CCACATTTGTAGAGGTTTTACTTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byInsert was cloned from Lamp1-mGFP, a gift from Esteban Dell‘Angelica (Addgene plasmid #34831; Falcón-Pérez et al., 2005).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit for https://www.biorxiv.org/content/10.1101/2022.08.12.503784v1 bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST_6xUAS:Lamp1-mGFP was a gift from Francesca Peri (Addgene plasmid # 192356 ; http://n2t.net/addgene:192356 ; RRID:Addgene_192356) -
For your References section:
A role for the centrosome in regulating the rate of neuronal efferocytosis by microglia in vivo. Moller K, Brambach M, Villani A, Gallo E, Gilmour D, Peri F. Elife. 2022 Nov 18;11:e82094. doi: 10.7554/eLife.82094. 10.7554/eLife.82094 PubMed 36398880