mGFP-hNET
(Plasmid
#193364)
-
Purposeexpression of human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cells
-
Depositing Lab
-
Depositing OrganizationMedical University of Vienna
Located in Austria -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193364 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 193364-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 193364-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6600
-
Modifications to backboneeGFP A206K mutation resulting in mGFP
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman Norepinephrine Transporter
-
Alt nameNET, NAT, SLC6A2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1850
-
Entrez GeneSLC6A2 (a.k.a. NAT1, NET, NET1, SLC6A5)
- Promoter CMV
-
Tag
/ Fusion Protein
- monomeric GFP (mGFP) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer EGFP-C1-fw: GAAGCGCGATCACATGGTC
- 3′ sequencing primer EGFP-C1-rv: AACCATTATAAGCTGCAATAAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 193364-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 193364-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mGFP-hNET was a gift from Harald Sitte (Addgene plasmid # 193364 ; http://n2t.net/addgene:193364 ; RRID:Addgene_193364) -
For your References section:
Phosphatidylinositol 4,5-bisphosphate (PIP2) facilitates norepinephrine transporter dimerization and modulates substrate efflux. Luethi D, Maier J, Rudin D, Szollosi D, Angenoorth TJF, Stankovic S, Schittmayer M, Burger I, Yang JW, Jaentsch K, Holy M, Das AK, Brameshuber M, Camacho-Hernandez GA, Casiraghi A, Newman AH, Kudlacek O, Birner-Gruenberger R, Stockner T, Schutz GJ, Sitte HH. Commun Biol. 2022 Nov 17;5(1):1259. doi: 10.1038/s42003-022-04210-1. 10.1038/s42003-022-04210-1 PubMed 36396757