Skip to main content

SBE-NLS-mCherry PGK-rtTA3
(Plasmid #195332)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195332 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PLKO
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    NLS-mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    762
  • Promoter miniCMV

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer CTCGCTCAAAAGCTGGGAGT
  • 3′ sequencing primer AGATCTTGTCTTCGTTGGGAGTGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    rtTA3
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Promoter hPGK

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GTAGTGTGGGCCCTGTTCCTGCC
  • 3′ sequencing primer AGCACAGCGGTATGACTTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SBE-NLS-mCherry PGK-rtTA3 was a gift from Elaine Fuchs (Addgene plasmid # 195332 ; http://n2t.net/addgene:195332 ; RRID:Addgene_195332)
  • For your References section:

    Ras drives malignancy through stem cell crosstalk with the microenvironment. Yuan S, Stewart KS, Yang Y, Abdusselamoglu MD, Parigi SM, Feinberg TY, Tumaneng K, Yang H, Levorse JM, Polak L, Ng D, Fuchs E. Nature. 2022 Nov 30. doi: 10.1038/s41586-022-05475-6. 10.1038/s41586-022-05475-6 PubMed 36450983