GFP-itis pBE-nt
(Plasmid
#195343)
-
PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195343 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneunknown
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameecTadA(8e)-SpCas9-NG
-
Alt nameABE8e A to G base editor
-
SpeciesSynthetic; E. coli
-
Insert Size (bp)4650
-
MutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F, A1322R, R1335V, T1337R
- Promoter ProC
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer cagctaacaccacgtcgt
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegRNA gtgcacgacgccgtatgcga
- Promoter Lac
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer gatcgacctgtctcagctgggaggt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.02.06.527367v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-itis pBE-nt was a gift from Alexis Komor (Addgene plasmid # 195343 ; http://n2t.net/addgene:195343 ; RRID:Addgene_195343) -
For your References section:
Curing "GFP-itis" in Bacteria with Base Editors: Development of a Genome Editing Science Program Implemented with High School Biology Students. Vasquez CA, Evanoff M, Ranzau BL, Gu S, Deters E, Komor AC. CRISPR J. 2023 Apr 20. doi: 10.1089/crispr.2023.0002. 10.1089/crispr.2023.0002 PubMed 37083425