Skip to main content

TRUPATH Triple Gagust
(Plasmid #196054)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196054 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone manufacturer
    Genscript
  • Backbone size w/o insert (bp) 5113
  • Total vector size (bp) 9883
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    GAlphaGustducin-RLuc8
  • Alt name
    GNAT3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2031
  • Mutation
    RLuc8 and flanking SGGGGS linkers have been inserted at amino acid position 117 of the alpha subunit
  • Entrez Gene
    GNAT3 (a.k.a. gustducin)
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer gccacgttgtgagttggatag
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GGamma1-GFP2
  • Alt name
    GNGT1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    954
  • Entrez Gene
    GNGT1 (a.k.a. GNG1, HG3G1)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP2 and GSAG linker (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer gagggcagaggaagtcttc
  • 3′ sequencing primer GATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    GBeta3
  • Alt name
    GNB3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1020
  • Entrez Gene
    GNB3 (a.k.a. CSNB1H, HG2D)
  • Promoter CMV

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ccggtagggccgggattc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    AddgeneTRUPATH Kit #1000000163

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TRUPATH Triple Gagust was a gift from Justin English (Addgene plasmid # 196054 ; http://n2t.net/addgene:196054 ; RRID:Addgene_196054)
  • For your References section:

    TRUPATH, an open-source biosensor platform for interrogating the GPCR transducerome. Olsen RHJ, DiBerto JF, English JG, Glaudin AM, Krumm BE, Slocum ST, Che T, Gavin AC, McCorvy JD, Roth BL, Strachan RT. Nat Chem Biol. 2020 May 4. pii: 10.1038/s41589-020-0535-8. doi: 10.1038/s41589-020-0535-8. 10.1038/s41589-020-0535-8 PubMed 32367019