pMG024 MBP-GSK3β-HA-His, GST_λPPase
(Plasmid #196182)

• Purpose: Co-expresses MBP-GSK3β-HA-His (human GSK3β as a fusion protein with MBP, HA, and His-tags) and GST_λPPase in E.coli to produce unphosphorylated MBP-GSK3β-HA-His
• Depositing Lab: Jesse Zalatan
• Publication: Gavagan et al Elife. 2023 Aug 7;12:e85444. doi: 10.7554/eLife.85444.

Backbone

• Vector backbone: pMBP-MG
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 6716
• Total vector size (bp): 9466
• Modifications to backbone: Modified to include an N-terminal TEV-cleavable MBP tag and a C-terminal His6 tag
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: GSK3B
• Alt name: Glycogen Synthase Kinase 3β
• Species: H. sapiens (human)
• Insert Size (bp): 1305
• GenBank ID: 2932 BC000251
• Entrez Gene: GSK3B
• Promoter: Tac
• Tags / Fusion Proteins:
  • MBP (N terminal on backbone)
  • His6 (C terminal on backbone)
  • HA (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: MalE Forward GGTCGTCAGACTGTCGATGAAGCC
• 3′ sequencing primer: M13F Reverse TGTAAAACGACGGCCAGT

Gene/Insert 2

• Gene/Insert name: λPPase
• Alt name: Lambda Phosphatase
• Alt name: serine/threonine protein phosphatase [Escherichia phage Lambda]
• Species: Bacteriophage lambda
• Insert Size (bp): 666
• GenBank ID: NC_001416.1
• Promoter: Tac
• Tag / Fusion Protein:
  • GST (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: pGEX 5' GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: M13F Reverse TGTAAAACGACGGCCAGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene #14753

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.12.05.519208 for bioRxiv preprint.