Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA6-N-3XFLAG-Gsk3b
(Plasmid #123592)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 123592 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA6
  • Backbone size w/o insert (bp) 5079
  • Total vector size (bp) 6342
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    glycogen synthase kinase 3 beta
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1263
  • GenBank ID
    NM_019827.7
  • Entrez Gene
    Gsk3b (a.k.a. 7330414F15Rik, 8430431H08Rik, GSK-3, GSK-3beta, GSK3)
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA6-N-3XFLAG-Gsk3b was a gift from Bruce Beutler (Addgene plasmid # 123592 ; http://n2t.net/addgene:123592 ; RRID:Addgene_123592)
  • For your References section:

    LMBR1L regulates lymphopoiesis through Wnt/beta-catenin signaling. Choi JH, Zhong X, McAlpine W, Liao TC, Zhang D, Fang B, Russell J, Ludwig S, Nair-Gill E, Zhang Z, Wang KW, Misawa T, Zhan X, Choi M, Wang T, Li X, Tang M, Sun Q, Yu L, Murray AR, Moresco EMY, Beutler B. Science. 2019 May 10;364(6440). pii: 364/6440/eaau0812. doi: 10.1126/science.aau0812. 10.1126/science.aau0812 PubMed 31073040