pMG071 MBP-GSK3β_S9A-HA-His, GST_λPPase
(Plasmid
#196185)
-
PurposeCo-expresses MBP-GSK3β_S9A-HA-His (human GSK3β with S9A mutation as a fusion protein with MBP, HA, and His-tags) and GST_λPPase in E.coli to produce unphosphorylated MBP-GSK3β_S9A-HA-His
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196185 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMBP-MG
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 6716
- Total vector size (bp) 9466
-
Modifications to backboneModified to include an N-terminal TEV-cleavable MBP tag and a C-terminal His6 tag
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameGSK3B
-
Alt nameGlycogen Synthase Kinase 3β
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1305
-
Mutationchanged Serine 9 to Alanine
-
GenBank ID2932 BC000251
-
Entrez GeneGSK3B
- Promoter Tac
-
Tags
/ Fusion Proteins
- MBP (N terminal on backbone)
- His6 (C terminal on backbone)
- HA (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer MalE Forward GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer GST_N Reverse GAGTGGGTTGCACAAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameλPPase
-
Alt nameLambda Phosphatase
-
Alt nameserine/threonine protein phosphatase [Escherichia phage Lambda]
-
SpeciesBacteriophage lambda
-
Insert Size (bp)666
-
GenBank IDNC_001416.1
- Promoter Tac
-
Tag
/ Fusion Protein
- GST (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer pGEX 5' GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer M13F Reverse TGTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene #14753
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.12.05.519208 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMG071 MBP-GSK3β_S9A-HA-His, GST_λPPase was a gift from Jesse Zalatan (Addgene plasmid # 196185 ; http://n2t.net/addgene:196185 ; RRID:Addgene_196185) -
For your References section:
The Axin scaffold protects the kinase GSK3β from cross-pathway inhibition. Gavagan M, Jameson N, Zalatan JG. bioRxiv 2022.12.05.519208 10.1101/2022.12.05.519208