Skip to main content

pLKO.1.sh.beta-catenin.2279
(Plasmid #19762)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 19762 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1 puro
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    small hairpin RNA against beta-catenin
  • Alt name
    CTNNB
  • Species
    H. sapiens (human)
  • Entrez Gene
    CTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

2279 refers to the shRNA
clone name from the RNAi Consortium at the Broad Institute and indicates the
location on the CTNNB1 mRNA that is targeted.

shRNA sequence for 2279 is:
CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1.sh.beta-catenin.2279 was a gift from William Hahn (Addgene plasmid # 19762 ; http://n2t.net/addgene:19762 ; RRID:Addgene_19762)
  • For your References section:

    CDK8 is a colorectal cancer oncogene that regulates beta-catenin activity. Firestein R, Bass AJ, Kim SY, Dunn IF, Silver SJ, Guney I, Freed E, Ligon AH, Vena N, Ogino S, Chheda MG, Tamayo P, Finn S, Shrestha Y, Boehm JS, Jain S, Bojarski E, Mermel C, Barretina J, Chan JA, Baselga J, Tabernero J, Root DE, Fuchs CS, Loda M, Shivdasani RA, Meyerson M, Hahn WC. Nature. 2008 Sep 25. 455(7212):547-51. 10.1038/nature07179 PubMed 18794900