-
PurposeNon-integrating (episomal) expression of mouse Oct3/4, Klf4 and Sox2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 19771 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCX
-
Backbone manufacturerJun-ichi Miyazaki
- Backbone size w/o insert (bp) 4778
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOct3/4-2A-Klf4-2A-Sox2
-
Alt namePou5f1
-
Alt nameSox2
-
Alt nameKlf4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3700
-
MutationThree genes are connected with the foot-and-mouth disease virus 2A self-cleaving sequence.
-
Entrez GeneSox2 (a.k.a. Sox-2, lcc, ysb)
-
Entrez GeneKlf4 (a.k.a. EZF, Gklf, Zie)
-
Entrez GenePou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCGAGCCGCAGCCATTGCCTTTTA
- 3′ sequencing primer TTAGCCAGAAGTCAGATGCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byCAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J.
-
Terms and Licenses
-
Articles Citing this Plasmid
Depositor Comments
Addgene has verified the insert size with an EcoRI digest. To see a picture of the digest, click on "Reviews" under Plasmid Links, to the right of this page.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCX-OKS-2A was a gift from Shinya Yamanaka (Addgene plasmid # 19771 ; http://n2t.net/addgene:19771 ; RRID:Addgene_19771) -
For your References section:
Generation of Mouse Induced Pluripotent Stem Cells Without Viral Vectors. Okita K, Nakagawa M, Hyenjong H, Ichisaka T, Yamanaka S. Science. 2008 Oct 9. ():. 10.1126/science.1164270 PubMed 18845712