Skip to main content

pCX-OKS-2A
(Plasmid #19771)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 19771 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 19771-D50 50 μg of DNA in Tris buffer $495
DNA 19771-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCX
  • Backbone manufacturer
    Jun-ichi Miyazaki
  • Backbone size w/o insert (bp) 4778
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Oct3/4-2A-Klf4-2A-Sox2
  • Alt name
    Pou5f1
  • Alt name
    Sox2
  • Alt name
    Klf4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3700
  • Mutation
    Three genes are connected with the foot-and-mouth disease virus 2A self-cleaving sequence.
  • Entrez Gene
    Sox2 (a.k.a. Sox-2, lcc, ysb)
  • Entrez Gene
    Klf4 (a.k.a. EZF, Gklf, Zie)
  • Entrez Gene
    Pou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCGAGCCGCAGCCATTGCCTTTTA
  • 3′ sequencing primer TTAGCCAGAAGTCAGATGCTC
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    CAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene has verified the insert size with an EcoRI digest. To see a picture of the digest, click on "Reviews" under Plasmid Links, to the right of this page.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCX-OKS-2A was a gift from Shinya Yamanaka (Addgene plasmid # 19771 ; http://n2t.net/addgene:19771 ; RRID:Addgene_19771)
  • For your References section:

    Generation of mouse induced pluripotent stem cells without viral vectors. Okita K, Nakagawa M, Hyenjong H, Ichisaka T, Yamanaka S. Science. 2008 Nov 7. 322(5903):949-53. 10.1126/science.1164270 PubMed 18845712