pCX-OKS-2A
(Plasmid #19771)

• Purpose: Non-integrating (episomal) expression of mouse Oct3/4, Klf4 and Sox2
• Depositing Lab: Shinya Yamanaka
• Publication: Okita et al Science. 2008 Nov 7. 322(5903):949-53.

Backbone

• Vector backbone: pCX
• Backbone manufacturer: Jun-ichi Miyazaki
• Backbone size w/o insert (bp): 4778
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Oct3/4-2A-Klf4-2A-Sox2
• Alt name: Pou5f1
• Alt name: Sox2
• Alt name: Klf4
• Species: M. musculus (mouse)
• Insert Size (bp): 3700
• Mutation: Three genes are connected with the foot-and-mouth disease virus 2A self-cleaving sequence.
• Entrez Gene: Sox2 (a.k.a. Sox-2, lcc, ysb)
• Entrez Gene: Klf4 (a.k.a. EZF, Gklf, Zie)
• Entrez Gene: Pou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GCGAGCCGCAGCCATTGCCTTTTA
• 3′ sequencing primer: TTAGCCAGAAGTCAGATGCTC

Resource Information

• Supplemental Documents:
  • Yamanaka gel
• Addgene Notes:
  • Addgene diagnostic digest
• A portion of this plasmid was derived from a plasmid made by: CAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J.
• Articles Citing this Plasmid:
  • 16 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene has verified the insert size with an EcoRI digest. To see a picture of the digest, click on "Reviews" under Plasmid Links, to the right of this page.