Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #19771)


Item Catalog # Description Quantity Price (USD)
Plasmid 19771 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Jun-ichi Miyazaki
  • Backbone size w/o insert (bp) 4778
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Alt name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
    Three genes are connected with the foot-and-mouth disease virus 2A self-cleaving sequence.
  • Entrez Gene
    Sox2 (a.k.a. Sox, Sox-2, lc, lcc, ys, ysb)
  • Entrez Gene
    Klf4 (a.k.a. EZF, Gkl, Gklf, Zi, Zie)
  • Entrez Gene
    Pou5f1 (a.k.a. NF-A3, Oct, Oct-, Oct-3, Oct-3/, Oct-3/4, Oct-4, Oct3, Oct3/, Oct3/4, Oct4, Otf, Otf-, Otf-3, Otf-4, Otf3, Otf3-, Otf3-rs7, Otf3g, Otf4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCGAGCCGCAGCCATTGCCTTTTA
  • 3′ sequencing primer TTAGCCAGAAGTCAGATGCTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    CAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

Addgene has verified the insert size with an EcoRI digest. To see a picture of the digest, click on "Reviews" under Plasmid Links, to the right of this page.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCX-OKS-2A was a gift from Shinya Yamanaka (Addgene plasmid # 19771 ; ; RRID:Addgene_19771)
  • For your References section:

    Generation of Mouse Induced Pluripotent Stem Cells Without Viral Vectors. Okita K, Nakagawa M, Hyenjong H, Ichisaka T, Yamanaka S. Science. 2008 Oct 9. ():. 10.1126/science.1164270 PubMed 18845712