pLL3.7m_tKiMBImut-T2A-AkaLuc-P2A-Blasticidin
(Plasmid
#199585)
-
PurposeExpress tKiMBImut(AA), AkaLuc and Blasticidin in a lentivirus vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199585 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLL3.7m
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 10585
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameERK tdTomato-Kinase-Modulated Bioluminescent Indicator(mutant)
-
Alt nameERK tKiMBImut
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2112
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ggtttagtgaaccgtcagatccgc
- 3′ sequencing primer GGAAGAAAACCCAGGGCCT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAkaLuc
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1650
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CCAGTGGATAAAGCAAAGCTGTC
- 3′ sequencing primer ttcttgagacaaaggcttgg
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameBlasticidin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)395
- Promoter CMV
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gacggcaagatcgccgtg
- 3′ sequencing primer tcaagcttatcgataatcaacctctgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLL3.7m_tKiMBImut-T2A-AkaLuc-P2A-Blasticidin was a gift from Michael Lin (Addgene plasmid # 199585 ; http://n2t.net/addgene:199585 ; RRID:Addgene_199585) -
For your References section:
Kinase-Modulated Bioluminescent Indicators Enable Noninvasive Imaging of Drug Activity in the Brain. Wu Y, Walker JR, Westberg M, Ning L, Monje M, Kirkland TA, Lin MZ, Su Y. ACS Cent Sci. 2023 Mar 20;9(4):719-732. doi: 10.1021/acscentsci.3c00074. eCollection 2023 Apr 26. 10.1021/acscentsci.3c00074 PubMed 37122464