pAAV-hSyn-con/fon DREADD Gq-mCherry
(Plasmid
#200661)
-
PurposeConstruct for chemogenetically activating and visualizing subpopulations of neurons in the retina
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200661 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4600
- Total vector size (bp) 7544
-
Vector typeMammalian Expression, Mouse Targeting, AAV, Cre/Lox ; INTRSECT
-
Selectable markersBeta-lactamase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsGrowth temperature 32C actual
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDREADD Gq-mCherry
-
Alt namehM3D-mCherry
-
SpeciesSynthetic
-
Insert Size (bp)3014
- Promoter hSyn
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer cagccggaccgcaccacgcga
- 3′ sequencing primer ggaggagaaaatgaaagccatacggg
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-con/fon DREADD Gq-mCherry was a gift from Samer Hattar (Addgene plasmid # 200661 ; http://n2t.net/addgene:200661 ; RRID:Addgene_200661)