pAAV-CamKIIa(0.4)-stChrimsonR-EGFP-P2A-PdCO-WPRE
(Plasmid
#202198)
-
PurposeExpresses bicistronically soma-targeted ChrimsonR in frame with EGFP and the optimized PdCO under control of minimal CamKIIa promotor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202198 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3762
- Total vector size (bp) 6915
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namestChrimsonR, PdCO
-
Alt nameChrimson K176R mutant
-
Alt namePlatynereis dumerilii Ciliary Opsin, optimized for mammalian neuron expression
-
SpeciesSynthetic; Chlamydomonas noctigama (Chrimson), Platynereis dumerilii (PdCO)
-
Insert Size (bp)3153
-
GenBank IDKF992060 (Chrimson) AY692353.1 (PdCO)
- Promoter CaMKIIα minimal promotor (0.4kb)
-
Tags
/ Fusion Proteins
- EGFP (C terminal on insert)
- Rho1D4 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CaMKIIa_F (gtttcggaggtggttgccatg)
- 3′ sequencing primer WPRE_R (ACCACGGAATTATCAGTGCCCA) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CamKIIa(0.4)-stChrimsonR-EGFP-P2A-PdCO-WPRE was a gift from Ofer Yizhar (Addgene plasmid # 202198 ; http://n2t.net/addgene:202198 ; RRID:Addgene_202198) -
For your References section:
A bistable inhibitory OptoGPCR for multiplexed optogenetic control of neural circuits. Wietek J, Nozownik A, Pulin M, Saraf-Sinik I, Matosevich N, Malan D, Brown BJ, Dine J, Levy R, Litvin A, Regev N, Subramaniam S, Bitton E, Benjamin A, Copits BA, Sasse P, Rost BR, Schmitz D, Soba P, Nir Y, Wiegert JS, Yizhar O. bioRxiv. 2023 Jul 2:2023.07.01.547328. doi: 10.1101/2023.07.01.547328. Preprint. 10.1101/2023.07.01.547328 PubMed 37425961