Skip to main content

LentiCRISPR v2 RB1 sgRNA #1
(Plasmid #202516)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202516 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LentiCRISPR v2
  • Backbone size w/o insert (bp) 14871
  • Total vector size (bp) 13013
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RB1 sgRNA
  • gRNA/shRNA sequence
    AAGTGAACGACATCTCATCT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_000321.3
  • Entrez Gene
    RB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer U6
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPR v2 RB1 sgRNA #1 was a gift from Ming Chen (Addgene plasmid # 202516 ; http://n2t.net/addgene:202516 ; RRID:Addgene_202516)
  • For your References section:

    RB1-deficient prostate tumor growth and metastasis are vulnerable to ferroptosis induction via the E2F/ACSL4 axis. Wang ME, Chen J, Lu Y, Bawcom AR, Wu J, Ou J, Asara JM, Armstrong AJ, Wang Q, Li L, Wang Y, Huang J, Chen M. J Clin Invest. 2023 Mar 16:e166647. doi: 10.1172/JCI166647. 10.1172/JCI166647 PubMed 36928314