LentiCRISPR v2 RB1 sgRNA #1
(Plasmid
#202516)
-
PurposeExpressing Cas9 and sgRNA targeting human RB1 gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202516 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiCRISPR v2
- Backbone size w/o insert (bp) 14871
- Total vector size (bp) 13013
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRB1 sgRNA
-
gRNA/shRNA sequenceAAGTGAACGACATCTCATCT
-
SpeciesH. sapiens (human)
-
GenBank IDNM_000321.3
-
Entrez GeneRB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer U6 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPR v2 RB1 sgRNA #1 was a gift from Ming Chen (Addgene plasmid # 202516 ; http://n2t.net/addgene:202516 ; RRID:Addgene_202516) -
For your References section:
RB1-deficient prostate tumor growth and metastasis are vulnerable to ferroptosis induction via the E2F/ACSL4 axis. Wang ME, Chen J, Lu Y, Bawcom AR, Wu J, Ou J, Asara JM, Armstrong AJ, Wang Q, Li L, Wang Y, Huang J, Chen M. J Clin Invest. 2023 Mar 16:e166647. doi: 10.1172/JCI166647. 10.1172/JCI166647 PubMed 36928314