Skip to main content

pmirGLO-3'UTR mouse Tnf
(Plasmid #207127)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207127 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmirGLO Dual-Luciferase miRNA Target Expression Vector
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 7362
  • Total vector size (bp) 8134
  • Modifications to backbone
    added EcoRI and SmaI restriction enzyme sites in the multiple cloning site
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tumor necrosis factor (Tnf) 3'UTR
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    498
  • GenBank ID
    NM_013693.3
  • Entrez Gene
    Tnf (a.k.a. DIF, TNF-a, TNF-alpha, TNFSF2, TNFalpha, Tnfa, Tnfsf1a, Tnlg1f)
  • Promoter PGK promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmirGLO-3'UTR mouse Tnf was a gift from Silvia Monticelli (Addgene plasmid # 207127 ; http://n2t.net/addgene:207127 ; RRID:Addgene_207127)
  • For your References section:

    The mRNA methyltransferase Mettl3 modulates cytokine mRNA stability and limits functional responses in mast cells. Leoni C, Bataclan M, Ito-Kureha T, Heissmeyer V, Monticelli S. Nat Commun. 2023 Jun 29;14(1):3862. doi: 10.1038/s41467-023-39614-y. 10.1038/s41467-023-39614-y PubMed 37386028