pmirGLO-3'UTR mouse Tnf
(Plasmid
#207127)
-
PurposeLuciferase vector containing 3'UTR for mouse Tnf
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207127 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepmirGLO Dual-Luciferase miRNA Target Expression Vector
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 7362
- Total vector size (bp) 8134
-
Modifications to backboneadded EcoRI and SmaI restriction enzyme sites in the multiple cloning site
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTumor necrosis factor (Tnf) 3'UTR
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)498
-
GenBank IDNM_013693.3
-
Entrez GeneTnf (a.k.a. DIF, TNF-a, TNF-alpha, TNFSF2, TNFalpha, Tnfa, Tnfsf1a, Tnlg1f)
- Promoter PGK promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmirGLO-3'UTR mouse Tnf was a gift from Silvia Monticelli (Addgene plasmid # 207127 ; http://n2t.net/addgene:207127 ; RRID:Addgene_207127) -
For your References section:
The mRNA methyltransferase Mettl3 modulates cytokine mRNA stability and limits functional responses in mast cells. Leoni C, Bataclan M, Ito-Kureha T, Heissmeyer V, Monticelli S. Nat Commun. 2023 Jun 29;14(1):3862. doi: 10.1038/s41467-023-39614-y. 10.1038/s41467-023-39614-y PubMed 37386028