GW1-rogRFP2
(Plasmid
#207876)
-
PurposeMammalian expression of the red fluorescent rogRFP2 redox sensor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207876 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneGW1
- Backbone size w/o insert (bp) 5274
- Total vector size (bp) 6660
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namerogRFP2
-
Alt nameroGFP2-mApple
-
SpeciesSynthetic
-
Insert Size (bp)1385
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGAATCGGAGTGAGTGC
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GW1-rogRFP2 was a gift from Mathew Tantama (Addgene plasmid # 207876 ; http://n2t.net/addgene:207876 ; RRID:Addgene_207876) -
For your References section:
Neuron Activity Dependent Redox Compartmentation Revealed with a Second Generation Red-Shifted Ratiometric Sensor. Radhakrishnan S, Norley J, Wendt S, LeRoy N, Hall H, Norcross S, Doan S, Snaider J, MacVicar BA, Weake VM, Huang L, Tantama M. ACS Chem Neurosci. 2020 Sep 2;11(17):2666-2678. doi: 10.1021/acschemneuro.0c00342. Epub 2020 Aug 21. 10.1021/acschemneuro.0c00342 PubMed 32786310