sgRNA_expression_vector
(Plasmid
#210212)
-
Purpose(Empty Backbone) An empty gRNA expression vector to clone U6 promoter driven sgRNAs with gRNA scaffold and with co-expression of DsRed. sgRNA can be cloned by Golden Gate Assembly or restriction digestion using BbsI.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210212 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMulti-sgRNA-LacZ-DsRed (Addgene Plasmid #99914)
-
Backbone manufacturerYujie Sun
- Backbone size (bp) 4643
-
Modifications to backboneMultiple sgRNA assembly region under Lac promoter in the Addgene Plasmid #99914 was replaced by the region U6 promoter to gRNA scaffold from AIO-mCherry plasmid ( Addgene #74120).
-
Vector typeMammalian Expression, Bacterial Expression
- Promoter U6
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGGTTTGTCCAAACTCATC
- 3′ sequencing primer GTGGACTCTTGTTCCAAACTGG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgRNA_expression_vector was a gift from Albert Jeltsch (Addgene plasmid # 210212 ; http://n2t.net/addgene:210212 ; RRID:Addgene_210212) -
For your References section:
Protocol for Allele-Specific Epigenome Editing Using CRISPR/dCas9. Rajaram N, Bashtrykov P, Jeltsch A. Methods Mol Biol. 2024;2842:179-192. doi: 10.1007/978-1-0716-4051-7_9. 10.1007/978-1-0716-4051-7_9 PubMed 39012596