Skip to main content

qMaLioffG
(Plasmid #212825)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212825 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(-)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    qMaLioffG
  • Insert Size (bp)
    1128
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.08.29.555275 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    qMaLioffG was a gift from Tetsuya Kitaguchi (Addgene plasmid # 212825 ; http://n2t.net/addgene:212825 ; RRID:Addgene_212825)
  • For your References section:

    qMaLioffG: a genetically encoded green fluorescence lifetime-based indicator enabling quantitative imaging of intracellular ATP. Arai S, Itoh H, Vu CQ, Nguyen LTN, Nakayama M, Oshima M, Morita A, Okamoto K, Okuda S, Teranishi A, Osawa M, Tamura Y, Nonoyama S, Takuma M, Fujie T, Sarker SR, Sudhaharan T, Furube A, Katayama T, Kiya T, Lane EB, Kitaguchi T. Nat Commun. 2025 Nov 13;16(1):9972. doi: 10.1038/s41467-025-64946-2. 10.1038/s41467-025-64946-2 PubMed 41233321