pRF+275Dux4
(Plasmid
#21293)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21293 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRF
- Backbone size w/o insert (bp) 6518
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDUX 4
-
Alt namedouble homeobox, chr 4
-
SpeciesH. sapiens (human); DUX 4
-
Insert Size (bp)275
-
Entrez GeneDUX4 (a.k.a. DUX4L)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer GCAAGAAGATGCACCTGATG
- 3′ sequencing primer AGGAACCAGGGCGTATCTCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRF+275Dux4 was a gift from Stephen Tapscott (Addgene plasmid # 21293 ; http://n2t.net/addgene:21293 ; RRID:Addgene_21293) -
For your References section:
RNA transcripts, miRNA-sized fragments and proteins produced from D4Z4 units: new candidates for the pathophysiology of facioscapulohumeral dystrophy. Snider L, Asawachaicharn A, Tyler AE, Geng LN, Petek LM, Maves L, Miller DG, Lemmers RJ, Winokur ST, Tawil R, van der Maarel SM, Filippova GN, Tapscott SJ. Hum Mol Genet. 2009 Jul 1;18(13):2414-30. doi: 10.1093/hmg/ddp180. Epub 2009 Apr 9. 10.1093/hmg/ddp180 PubMed 19359275
Map uploaded by the depositor.
