-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21771 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneYIPlac204
- Backbone size w/o insert (bp) 4000
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGreen Fluorescent Protein (GFP)
-
Alt nameGFP
-
Alt nameEGFP
-
SpeciesAequorea victoria
-
Insert Size (bp)860
-
Tags
/ Fusion Proteins
- preKar2 (N terminal on insert)
- HDEL (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CTACAAAAAACACATACATAAACT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YIPlac204TKC-GFP-HDEL was a gift from Benjamin Glick (Addgene plasmid # 21771 ; http://n2t.net/addgene:21771 ; RRID:Addgene_21771) -
For your References section:
A role for actin, Cdc1p, and Myo2p in the inheritance of late Golgi elements in Saccharomyces cerevisiae. Rossanese OW, Reinke CA, Bevis BJ, Hammond AT, Sears IB, O'Connor J, Glick BS. J Cell Biol. 2001 Apr 2. 153(1):47-62. 10.1083/jcb.153.1.47 PubMed 11285273