pHPHS853
(Plasmid
#228236)
-
PurposeBxb1 attB_GA mCherry-T2A-puro, Dox-inducible EYFP reporter for integration into Bxb1 attP_GA landing pad
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228236 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneYTK089
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemCherry
- Promoter none
-
Tag
/ Fusion Protein
- PuroR
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CAAATAAAGCAATAGCATCAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEYFP
- Promoter TRE3GV
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AATGATACGGCGACCACCGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.07.25.605204 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHPHS853 was a gift from Arvind Rasi Subramaniam (Addgene plasmid # 228236 ; http://n2t.net/addgene:228236 ; RRID:Addgene_228236) -
For your References section:
Decoding post-transcriptional regulatory networks by RNA-linked CRISPR screening in human cells. Nugent PJ, Park H, Wladyka CL, Yelland JN, Sinha S, Chen KY, Bynum C, Quarterman G, Lee SC, Hsieh AC, Subramaniam AR. Nat Methods. 2025 Jun;22(6):1237-1246. doi: 10.1038/s41592-025-02702-6. Epub 2025 May 29. 10.1038/s41592-025-02702-6 PubMed 40442371