pAG mKappa Empty
(Plasmid #242954)

• Purpose: (Empty Backbone) Expresses mouse kappa light chain constant region. Users can clone in their desired light chain variable region for mammalian expression; to be used with pAG mIgG2a Empty heavy chain (Plasmid 242953)
• Depositing Labs: Meghan Rego, Addgene Research Program
• Publication: Addgene Antibody Plasmids (unpublished)

Backbone

• Vector backbone: pAG AB
• Backbone manufacturer: Addgene
• Backbone size (bp): 4244
• Vector type: Mammalian Expression
• Promoter: CMV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgggctgatgctgcaccaac
• 3′ sequencing primer: ggccctcgaggacgccagca

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

Plasmid 242954 pAG mKappa Empty encodes the mouse kappa light chain constant region and a filler sequence in lieu of a light chain variable region. To clone in your desired light chain variable region in frame with the mouse kappa light chain constant region, Addgene recommends the NEB Hifi assembly method.

PCR Amplify the backbone from plasmid 242954 pAG mKappa Empty with the following primers: 5’-cgggctgatgctgcaccaac and 5’-ggccctcgaggacgccagca.

Synthesize a gene fragment of the desired light chain variable region with flanking sequences that overlap with the backbone PCR product 5’-tgctggcgtcctcgagggcc-Gene fragment-cgggctgatgctgcaccaac

Assemble with the NEB HiFI assembly (NEB #E2621S) following the manufacturer’s recommendations