-
PurposeLentiviral expression of nls-Cre from the CMV promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO.1
- Backbone size w/o insert (bp) 6543
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsStbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre recombinase
-
Alt namenlsCre
-
Speciesbacteriophage
-
Insert Size (bp)1053
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer CCTTCACCGAGGGCCTATTTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Second AgeI site is introduced preventing AgeI-EcoRI shRNA subcloning. TRC library shRNAs can be subcloned as an AccI fragment.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LV-Cre pLKO.1 was a gift from Elaine Fuchs (Addgene plasmid # 25997 ; http://n2t.net/addgene:25997 ; RRID:Addgene_25997) -
For your References section:
Rapid functional dissection of genetic networks via tissue-specific transduction and RNAi in mouse embryos. Beronja S, Livshits G, Williams S, Fuchs E. Nat Med. 2010 Jul . 16(7):821-7. 10.1038/nm.2167 PubMed 20526348