Skip to main content

pEnt R3L2-MCS
(Plasmid #26799)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26799 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEntr2B
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2100
  • Vector type
    Gateway Entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    multiple cloning sequence
  • Alt name
    MCS
  • Insert Size (bp)
    200

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCTACAAACTCTTCCTGTTAGT
  • 3′ sequencing primer AGAGATTTTGAGACACGGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Empty entry vector carrying Gateway R3L2 sites, with MCS. This plasmid can act as an empty carrier when combined with a L1L3 plasmid to generate expression plasmids carrying just the L1L3 component.

This plasmid was constructed as follows: The pEntr2B entry vector was digested with AflII and XhoI to remove the attL1 and ccdb genes. Oligos
containing the attR3 site flanked by AflII on the 5' end and a polylinker (NotI-PacI-Bsu36I-NdeI-XhoI) on the 3' end were ligated to generate pEntR3L2-MCS.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEnt R3L2-MCS was a gift from Edward Hsiao (Addgene plasmid # 26799 ; http://n2t.net/addgene:26799 ; RRID:Addgene_26799)
  • For your References section:

    Constitutive Gs activation using a single-construct tetracycline-inducible expression system in embryonic stem cells and mice. Hsiao EC, Nguyen TD, Ng JK, Scott MJ, Chang WC, Zahed H, Conklin BR. Stem Cell Res Ther. 2011 Mar 4. 2(2):11. 10.1186/scrt52 PubMed 21375737