Skip to main content

Green-Camuialpha
(Plasmid #26933)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26933 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Clontech N1
  • Backbone size w/o insert (bp) 3927
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    REACh-CaMKIIa-mEGFP
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2913
  • Tags / Fusion Proteins
    • REACh (N terminal on insert)
    • mEGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site NotI, XbaI, MfeI, etc (destroyed during cloning)
  • 5′ sequencing primer AAATGGGCGGTAGGCGTGTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Green-Camuialpha was a gift from Ryohei Yasuda (Addgene plasmid # 26933 ; http://n2t.net/addgene:26933 ; RRID:Addgene_26933)
  • For your References section:

    Activation of CaMKII in single dendritic spines during long-term potentiation. Lee SJ, Escobedo-Lozoya Y, Szatmari EM, Yasuda R. Nature. 2009 Mar 19. 458(7236):299-304. 10.1038/nature07842 PubMed 19295602