-
Purpose3rd gen lentiviral expression of humanized ChR2 with E123T/H134R mutations fused to EYFP driven by CaMKIIa promoter for optogenetic activation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26967 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 9250
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsStbl3 (rec A-) cells to avoid recombinations with the LTRs
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehChR2(E123T/H134R)-EYFP
-
Alt nameChETA-EYFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1662
-
MutationE123T
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI, AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ctcagaagccccaagctcgtc
- 3′ sequencing primer GCAATAGCATGATACAAAGG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid contains the mouse calcium/calmodulin-dependent kinase II alpha subunit promoter.
For additional information please visit - http://www.optogenetics.org
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CaMKIIa-ChETA-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 26967 ; http://n2t.net/addgene:26967 ; RRID:Addgene_26967) -
For your References section:
Ultrafast optogenetic control. Gunaydin LA, Yizhar O, Berndt A, Sohal VS, Deisseroth K, Hegemann P. Nat Neurosci. 2010 Mar;13(3):387-92. doi: 10.1038/nn.2495. 10.1038/nn.2495 PubMed 20081849