pEnt R3L2 TetO(fl)-3
(Plasmid
#27107)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 27107 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEntr2B
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2300
-
Vector typeEntry Vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTetO promoter
-
Insert Size (bp)1300
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TCTACAAACTCTTCCTGTTAGT
- 3′ sequencing primer AGAGATTTTGAGACACGGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains Gateway R3L2 sites and full-length (7 repeat) TetO. SbfI, FseI, AvrII, and SalI sites can be used to insert gene of interest, driven by TetO. Does not contain insulator sequence.
This plasmid was constructed as follows: The pEntr2B entry vector was digested with AflII and XhoI to remove the attL1 and ccdb genes. Oligos
containing the attR3 site flanked by AflII on the 5' end and a polylinker (NotI-PacI-Bsu36I-NdeI-XhoI) on the 3' end were ligated to generate the empty pEntR3L2-MCS intermediate (Addgene plasmid number 26799). Using PCR cloning, the TetO-beta globin
intron sequence from pTetO (pUHD10.3) was cloned into the NotI/PacI sites in the reverse orientation,
and a 3' SbfI site was introduced. The pA sequence from pDest27 (Invitrogen) was then cloned into the
NotI/SbfI sites, again in reverse orientation. A LoxP site was introduced into the NdeI/XhoI sites, allowing full
excision of the targeted construct when used together with the LoxP site in the pEntl1L3 vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEnt R3L2 TetO(fl)-3 was a gift from Edward Hsiao (Addgene plasmid # 27107 ; http://n2t.net/addgene:27107 ; RRID:Addgene_27107) -
For your References section:
Constitutive Gs activation using a single-construct tetracycline-inducible expression system in embryonic stem cells and mice. Hsiao EC, Nguyen TD, Ng JK, Scott MJ, Chang WC, Zahed H, Conklin BR. Stem Cell Res Ther. 2011 Mar 4. 2(2):11. 10.1186/scrt52 PubMed 21375737