-
PurposeLentiviral coexpression of Cre and puromycin from the human EF1a promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 30205 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE2
- Backbone size w/o insert (bp) 8164
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsLB broth at 37C, shaken at ~150 rotations/minute overnight.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre recombinase
-
SpeciesEnterobacteria phage P1
-
Insert Size (bp)1065
-
GenBank IDX03453
-
Entrez Genecre (a.k.a. P1_gp003)
- Promoter EF1alpha
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (not destroyed)
- 3′ cloning site BamHI/BglII (destroyed during cloning)
- 5′ sequencing primer GGTTCATTCTCAAGCCTCAGACAGTG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cre-IRES-PuroR was a gift from Darrell Kotton (Addgene plasmid # 30205 ; http://n2t.net/addgene:30205 ; RRID:Addgene_30205) -
For your References section:
Generation of transgene-free lung disease-specific human induced pluripotent stem cells using a single excisable lentiviral stem cell cassette. Somers A, Jean JC, Sommer CA, Omari A, Ford CC, Mills JA, Ying L, Sommer AG, Jean JM, Smith BW, Lafyatis R, Demierre MF, Weiss DJ, French DL, Gadue P, Murphy GJ, Mostoslavsky G, Kotton DN. Stem Cells. 2010 Oct . 28(10):1728-40. 10.1002/stem.495 PubMed 20715179