-
PurposetRNA synthetase/tRNA pair for the in vivo incorporation of a photocrosslinker, p-azido-l-phenylalanine, into proteins in E coli response to the amber codon, TAG
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31186 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15A
- Backbone size w/o insert (bp) 5000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAny strain for growth, 37 oC, LB/2XYT media
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameM.j. p-azidohenylalanine RS (2 copies +tRNA)
-
Alt namepEVOL-pAz
-
SpeciesM.jannaschii
-
Insert Size (bp)1000
-
MutationY32T, E107N, D158P, I159L, L162Q, D286R
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer ATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTT
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEVOL-pAzF was a gift from Peter Schultz (Addgene plasmid # 31186 ; http://n2t.net/addgene:31186 ; RRID:Addgene_31186) -
For your References section:
Addition of p-azido-L-phenylalanine to the genetic code of Escherichia coli. Chin JW, Santoro SW, Martin AB, King DS, Wang L, Schultz PG. J Am Chem Soc. 2002 Aug 7;124(31):9026-7. 10.1021/ja027007w PubMed 12148987