-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31981 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTriEx 3
- Backbone size w/o insert (bp) 5000
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLOVS1K
-
SpeciesH. sapiens (human); Avena sativa (oat)
-
Insert Size (bp)1100
-
Tag
/ Fusion Protein
- RFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer (TriEx UP) GTTATTGTGCTGTCTCATCA
- 3′ sequencing primer T7 terminal (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning primers:
5' end:
CATGCCATGGGGACTAGTTTGGCTACTACACTTGAACGTATTGA
3' end:
CTAGCTAGCCAGTGAGTGGATGCCAGGGTTG
LOVS1K should be co-expressed with Orai1, such as Orai1 CFP (http://www.addgene.org/19757) or Orai1 YFP (http://www.addgene.org/19756/) deposited by Anjana Rao.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LOVS1K was a gift from Kevin Truong (Addgene plasmid # 31981 ; http://n2t.net/addgene:31981 ; RRID:Addgene_31981) -
For your References section:
A synthetic photoactivated protein to generate local or global ca(2+) signals. Pham E, Mills E, Truong K. Chem Biol. 2011 Jul 29;18(7):880-90. 10.1016/j.chembiol.2011.04.014 PubMed 21802009
Map uploaded by the depositor.
