-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32395 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepSub201
- Backbone size w/o insert (bp) 8310
-
Vector typeMammalian Expression, AAV ; Adeno-Associated Virus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl2
-
Growth instructionsUsers must confirm the absence of deletions (recombinations) in this vector by diagnostic digests. (1) A SmaI digest should produce the following pattern of bands: 3654 bp, 1716 bp and 1500 bp. (2) An AhdI digest should produce the following pattern of bands: 3183 bp, 2582 bp and 1127 bp. Please consult the associated publication listed below for an example gel image.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGFP
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Multiple (see map) (not destroyed)
- 3′ cloning site Multiple (see map) (not destroyed)
- 5′ sequencing primer GGCCCTTTTGCTAATCATGTTCATACCTCTTATCT
- 3′ sequencing primer GGCCAGGGCATTAGCCACACCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was received by Dr. Gray’s lab from the Richard Mulligan lab of Harvard University.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see Notes from Addgene link above for Addgene's diagnostic digests of this plasmid with AhdI and SmaI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-GFP was a gift from John T Gray (Addgene plasmid # 32395 ; http://n2t.net/addgene:32395 ; RRID:Addgene_32395) -
For your References section:
Design and Construction of Functional AAV Vectors. Gray JT, Zolotukhin S. Methods Mol Biol. 2011;807:25-46. 10.1007/978-1-61779-370-7_2 PubMed 22034025