Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO.1-GSK3β-#2
(Plasmid #32497)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32497 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    Sabatini Lab
  • Backbone size w/o insert (bp) 7000
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GSK3B
  • gRNA/shRNA sequence
    (AAA)GCTAGATCACTGTAACA
  • Species
    H. sapiens (human)
  • Entrez Gene
    GSK3B
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (unknown if destroyed)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer LKO.1 (GACTATCATATGCTTACCGT)
  • 3′ sequencing primer none
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-GSK3β-#2 was a gift from Alex Toker (Addgene plasmid # 32497 ; http://n2t.net/addgene:32497 ; RRID:Addgene_32497)
  • For your References section:

    Akt/protein kinase b and glycogen synthase kinase-3beta signaling pathway regulates cell migration through the NFAT1 transcription factor. Yoeli-Lerner M, Chin YR, Hansen CK, Toker A. Mol Cancer Res. 2009 Mar;7(3):425-32. Epub 2009 Mar 3. 10.1158/1541-7786.MCR-08-0342 PubMed 19258413