Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pUCBB-pT7-eGFP
(Plasmid #32552)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32552 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUCBB
  • Backbone manufacturer
    Schmidt-Dannert Lab
  • Backbone size w/o insert (bp) 2356
  • Modifications to backbone
    Replaced Constitutive lac promoter with pT7 promoter
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Insert Size (bp)
    719
  • Entrez Gene
    eGFP (a.k.a. pPRS3a_01)
  • Promoter pT7
  • Tag / Fusion Protein
    • His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer not designed
  • 3′ sequencing primer pBBinR (GCAGGTCCTGAAGTTAACTAG)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUCBB-pT7-eGFP was a gift from Claudia Schmidt-dannert (Addgene plasmid # 32552 ; http://n2t.net/addgene:32552 ; RRID:Addgene_32552)
  • For your References section:

    Optimized compatible set of BioBrick vectors for metabolic pathway engineering. Vick JE, Johnson ET, Choudhary S, Bloch SE, Lopez-Gallego F, Srivastava P, Tikh IB, Wawrzyn GT, Schmidt-Dannert C. Appl Microbiol Biotechnol. 2011 Dec;92(6):1275-86. Epub 2011 Oct 28. 10.1007/s00253-011-3633-4 PubMed 22033566