Skip to main content

pUCBB-pBAD-eGFP
(Plasmid #32553)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32553 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUCBB
  • Backbone manufacturer
    Schmidt-Dannert Lab
  • Backbone size w/o insert (bp) 3488
  • Modifications to backbone
    Biobrick section contains the araC gene to control expression from the pBAD promoter. It will move with the BioBrick.
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Insert Size (bp)
    719
  • Entrez Gene
    eGFP (a.k.a. pPRS3a_01)
  • Promoter pBAD
  • Tag / Fusion Protein
    • His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer not designed
  • 3′ sequencing primer pBBinR (GCAGGTCCTGAAGTTAACTAG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUCBB-pBAD-eGFP was a gift from Claudia Schmidt-dannert (Addgene plasmid # 32553 ; http://n2t.net/addgene:32553 ; RRID:Addgene_32553)
  • For your References section:

    Optimized compatible set of BioBrick vectors for metabolic pathway engineering. Vick JE, Johnson ET, Choudhary S, Bloch SE, Lopez-Gallego F, Srivastava P, Tikh IB, Wawrzyn GT, Schmidt-Dannert C. Appl Microbiol Biotechnol. 2011 Dec;92(6):1275-86. Epub 2011 Oct 28. 10.1007/s00253-011-3633-4 PubMed 22033566