pTrcHisA-rat-PTP1B
(Plasmid #35987)

• Depositing Lab: Anna Huttenlocher
• Publication: Cortesio et al J Cell Biol. 2008 Mar 10;180(5):957-71.

Backbone

• Vector backbone: pTrcHis A
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4407
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: protein tyrosine phosphatase 1B
• Alt name: PTP1B
• Species: R. norvegicus (rat)
• Insert Size (bp): 1299
• Entrez Gene: Ptpn1 (a.k.a. Ptp)
• Tags / Fusion Proteins:
  • His (N terminal on insert)
  • Xpress Epitope Tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH I (not destroyed)
• 3′ cloning site: Bgl II (not destroyed)
• 5′ sequencing primer: pTrcHis fwd GAGGTATATATTAATGTATCG
• 3′ sequencing primer: pTrcHis rev CCTGATACAGATTAAATC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GFP (EGFP)-PTP1B-HA construct was a gift from C. Arregui (University of San Martin, Buenos Aires, Argentina)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry