Skip to main content

pLKO-puro-sh-mFAK C
(Plasmid #37015)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37015 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1 puro (Addgene plasmid 8453)
  • Backbone manufacturer
    Weinberg lab
  • Backbone size w/o insert (bp) 7032
  • Total vector size (bp) 7090
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sh-mFAK C
  • Alt name
    FAK
  • Alt name
    shRNA against mouse FAK
  • gRNA/shRNA sequence
    CGGTCCAATGACAAGGTATAT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ptk2 (a.k.a. FADK 1, FAK, FRNK, Fadk, p125FAK)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-puro-sh-mFAK C was a gift from Bob Weinberg (Addgene plasmid # 37015 ; http://n2t.net/addgene:37015 ; RRID:Addgene_37015)
  • For your References section:

    Integrin beta1-focal adhesion kinase signaling directs the proliferation of metastatic cancer cells disseminated in the lungs. Shibue T, Weinberg RA. Proc Natl Acad Sci U S A. 2009 Jun 23;106(25):10290-5. Epub 2009 Jun 5. 10.1073/pnas.0904227106 PubMed 19502425