Skip to main content
Addgene

Hsp68-LacZ-Gateway
(Plasmid #37843)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37843 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    NA
  • Vector type
    Mouse Targeting
  • Promoter Mouse Hsp68 minimal promoter

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TGTGAGCGGATAACAATTTCAC
  • 3′ sequencing primer CTCAGTTTGGATGTTCCTGGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hsp68-LacZ-Gateway was a gift from Nadav Ahituv (Addgene plasmid # 37843 ; http://n2t.net/addgene:37843 ; RRID:Addgene_37843)
  • For your References section:

    In vivo enhancer analysis of human conserved non-coding sequences. Pennacchio LA, Ahituv N, Moses AM, Prabhakar S, Nobrega MA, Shoukry M, Minovitsky S, Dubchak I, Holt A, Lewis KD, Plajzer-Frick I, Akiyama J, De Val S, Afzal V, Black BL, Couronne O, Eisen MB, Visel A, Rubin EM. Nature. 2006 Nov 23;444(7118):499-502. Epub 2006 Nov 5. 10.1038/nature05295 PubMed 17086198