pcDNA3.1-CD8bM-3
(Plasmid
#40080)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40080 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerLife Technologies
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6101
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD8bM-3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)701
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer gtacctaggatgcggccgcggctgt
- 3′ sequencing primer gccggtcgactcagtagtccattctggaacatttc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr Hiro Nakauchi, Japan Science Technology Agency, Tokyo, Japan
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-CD8bM-3 was a gift from Paula Kavathas (Addgene plasmid # 40080 ; http://n2t.net/addgene:40080 ; RRID:Addgene_40080) -
For your References section:
Differential expression of the human CD8beta splice variants and regulation of the M-2 isoform by ubiquitination. Thakral D, Dobbins J, Devine L, Kavathas PB. J Immunol. 2008 Jun 1;180(11):7431-42. PubMed 18490743
Map uploaded by the depositor.