mutpRL-TK 3xUTR
(Plasmid
#40758)
-
PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNA
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40758 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonemutpRL-TK
-
Backbone manufacturerSharp Lab (http://web.mit.edu/sharplab/RNAi/Cloning.html)
-
Modifications to backbonepRL-TK (Promega) was digested with XbaI, and the following ligated in: ctagattccgagatatcggtaatgggcc This produced a modified vector, still containing an XbaI site, but now also containing an ApaI site, to allow for directional cloning of 3' UTR inserts. Final vector: TAATTctagattccgagatatcggtaatgggccCTAGA
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3 copies of the CXCR4 small RNA target site
-
Mutationmutated from TAG to CTC at nt 387–389 of the Renilla luciferase open reading frame to generate mismatches with seed positions 5, 6, and 7 of the siRNA guide strand by PCR-directed mutagenesis
- Promoter TK
-
Tag
/ Fusion Protein
- luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer CCAATGCTATTGTTGAAGGTGCCAAG
- 3′ sequencing primer CACTGCATTCTAGTTGTGGTTTGTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mutpRL-TK 3xUTR was a gift from Phillip Zamore (Addgene plasmid # 40758 ; http://n2t.net/addgene:40758 ; RRID:Addgene_40758) -
For your References section:
Argonaute protein identity and pairing geometry determine cooperativity in mammalian RNA silencing. Broderick JA, Salomon WE, Ryder SP, Aronin N, Zamore PD. RNA. 2011 Oct;17(10):1858-69. Epub 2011 Aug 30. 10.1261/rna.2778911 PubMed 21878547