Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEGFP PICH (Nigg CB62)
(Plasmid #41163)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 41163 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 8453
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PICH
  • Alt name
    ERCC6L
  • Alt name
    excision repair cross-complementing rodent repair deficiency, complementation group 6-like
  • Alt name
    RAD26L
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3753
  • GenBank ID
    NM_017669.2 BC111486.1
  • Entrez Gene
    ERCC6L (a.k.a. PICH, RAD26L)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer EGFP-C; CMV-F
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The complete ORF of PICH (corresponding exactly to FLJ20105; Acc. No. BC111486) was amplified by nested PCR, using a HeLa Marathon library (Clontech laboratories Inc.), and cloned into pEGFP-C1 vector (Clontech laboratories Inc.). The following primer pairs were used: primer pair 1: AAG CTC CAG CTC CAA GCT CC and TGC TTT TTG AGA TCT TTC TTG CC, primer pair 2: GACTCGAGCTATGGAGGCATCCCGAAGGTTTC and GCCCGGGTCAATTGTTATTAAGTTGC. These primers contain Xho1 and Xma1 sites, respectively, used for cloning.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP PICH (Nigg CB62) was a gift from Erich Nigg (Addgene plasmid # 41163 ; http://n2t.net/addgene:41163 ; RRID:Addgene_41163)
  • For your References section:

    PICH, a centromere-associated SNF2 family ATPase, is regulated by Plk1 and required for the spindle checkpoint. Baumann C, Korner R, Hofmann K, Nigg EA. Cell. 2007 Jan 12;128(1):101-14. 10.1016/j.cell.2006.11.041 PubMed 17218258