-
Depositing Labs
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEF-Bos
-
Backbone manufacturerMizushima and Nagata (Osaka Bioscience Institute, Japan, 1990) (PMID: 1698283)
- Backbone size w/o insert (bp) 5685
- Total vector size (bp) 6397
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMAL
-
Alt nameTIRAP
-
Alt nameMyD88 adapter–like protein
-
Alt nameTIR domain–containing adapter protein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)712
-
GenBank IDNM_148910.2 NP_683708.1
-
Entrez GeneTIRAP (a.k.a. BACTS1, Mal, MyD88-2, wyatt)
- Promoter EF1a
-
Tags
/ Fusion Proteins
- Flag (C terminal on backbone)
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer EF-1aF
- 3′ sequencing primer G-CSF-R (GATGGGGAACACTGCTGTTTA)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The depositing lab generated pEF-Bos MAL Flag from a human peripheral blood mononuclear cell (PBMC) complementary DNA library by PCR amplification and cloning. It was cloned with XhoI at the 5' end and BamHI at the 3' end. NotI can be used at the 3' end to excise the tagged CDS. The depositor's provided sequence includes some flanking EF-BOS sequence. The construct also contains a HIS tag.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF-Bos MAL Flag was a gift from Kate Fitzgerald & Tom Maniatis (Addgene plasmid # 41554 ; http://n2t.net/addgene:41554 ; RRID:Addgene_41554) -
For your References section:
IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Fitzgerald KA, McWhirter SM, Faia KL, Rowe DC, Latz E, Golenbock DT, Coyle AJ, Liao SM, Maniatis T. Nat Immunol. 2003 May;4(5):491-6. 10.1038/ni921 PubMed 12692549
Map uploaded by the depositor.