Skip to main content

pEF-Bos MAL Flag
(Plasmid #41554)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41554 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEF-Bos
  • Backbone manufacturer
    Mizushima and Nagata (Osaka Bioscience Institute, Japan, 1990) (PMID: 1698283)
  • Backbone size w/o insert (bp) 5685
  • Total vector size (bp) 6397
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MAL
  • Alt name
    TIRAP
  • Alt name
    MyD88 adapter–like protein
  • Alt name
    TIR domain–containing adapter protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    712
  • GenBank ID
    NM_148910.2 NP_683708.1
  • Entrez Gene
    TIRAP (a.k.a. BACTS1, Mal, MyD88-2, wyatt)
  • Promoter EF1a
  • Tags / Fusion Proteins
    • Flag (C terminal on backbone)
    • 6xHis (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer EF-1aF
  • 3′ sequencing primer G-CSF-R (GATGGGGAACACTGCTGTTTA)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The depositing lab generated pEF-Bos MAL Flag from a human peripheral blood mononuclear cell (PBMC) complementary DNA library by PCR amplification and cloning. It was cloned with XhoI at the 5' end and BamHI at the 3' end. NotI can be used at the 3' end to excise the tagged CDS. The depositor's provided sequence includes some flanking EF-BOS sequence. The construct also contains a HIS tag.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF-Bos MAL Flag was a gift from Kate Fitzgerald & Tom Maniatis (Addgene plasmid # 41554 ; http://n2t.net/addgene:41554 ; RRID:Addgene_41554)
  • For your References section:

    IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Fitzgerald KA, McWhirter SM, Faia KL, Rowe DC, Latz E, Golenbock DT, Coyle AJ, Liao SM, Maniatis T. Nat Immunol. 2003 May;4(5):491-6. 10.1038/ni921 PubMed 12692549