Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #44185)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 44185 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    BD Biosciences Clontech
  • Backbone size w/o insert (bp) 5300
  • Total vector size (bp) 9000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    EGFR (a.k.a. ERBB, ERBB1, HER1, NISBD2, PIG61, mENA)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3C cleavge site, protein C peptide tag, his6, SBP tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TTGGCACCAAAATCAACGGGACT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid expresses full-length, mature human EGFR (amino acids 1−1186) and does not include the 24aa signal peptide sequence in GenBank reference sequence NP_005219.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFR-ET1 was a gift from Timothy Springer (Addgene plasmid # 44185 ; ; RRID:Addgene_44185)
  • For your References section:

    Functional and structural stability of the epidermal growth factor receptor in detergent micelles and phospholipid nanodiscs. Mi LZ, Grey MJ, Nishida N, Walz T, Lu C, Springer TA. Biochemistry. 2008 Sep 30;47(39):10314-23. doi: 10.1021/bi801006s. Epub 2008 Sep 5. 10.1021/bi801006s PubMed 18771282