EGFR-ET1
(Plasmid
#44185)
-
Depositing Lab
-
Depositing OrganizationBoston Children's Hospital
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44185 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepIRES2-EGFP
-
Backbone manufacturerBD Biosciences Clontech
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 9000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFR-ET1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3870
-
MutationI104V and D254N relative to NP_005219.2
-
Entrez GeneEGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, NNCIS, PIG61, mENA)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3C cleavge site, protein C peptide tag, his6, SBP tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TTGGCACCAAAATCAACGGGACT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid expresses full-length, mature human EGFR (amino acids 1−1186) and does not include the 24aa signal peptide sequence in GenBank reference sequence NP_005219.
Addgene NGS identified the I104V and D254N mutations relative to NP_005219.2. The depositor has confirmed that these were present in the original plasmid as used in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFR-ET1 was a gift from Timothy Springer (Addgene plasmid # 44185 ; http://n2t.net/addgene:44185 ; RRID:Addgene_44185) -
For your References section:
Functional and structural stability of the epidermal growth factor receptor in detergent micelles and phospholipid nanodiscs. Mi LZ, Grey MJ, Nishida N, Walz T, Lu C, Springer TA. Biochemistry. 2008 Sep 30;47(39):10314-23. doi: 10.1021/bi801006s. Epub 2008 Sep 5. 10.1021/bi801006s PubMed 18771282