Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCRISPR::rpsL
(Plasmid #44505)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44505 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pZE21-MCS1
  • Backbone size w/o insert (bp) 2254
  • Total vector size (bp) 2433
  • Vector type
    CRISPR ; E.coli

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRISPR::rpsL
  • Entrez Gene
    rpsL (a.k.a. b3342, ECK3329, asuB, strA)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA target sequence aaaaaaccgaactccgcgctgcgtaaagta

This plasmid is also known as pDB130.

For more information on Marraffini Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/marraffini/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPR::rpsL was a gift from Luciano Marraffini (Addgene plasmid # 44505 ; http://n2t.net/addgene:44505 ; RRID:Addgene_44505)
  • For your References section:

    RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2508. 10.1038/nbt.2508 PubMed 23360965