Skip to main content

pCAG-Brainbow3.0
(Plasmid #45176)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45176 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG(gateway)
  • Total vector size (bp) 3400
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pCAG-Brainbow3.0
  • Species
    jelly fish and coral fluorescent proteins
  • Insert Size (bp)
    3400

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ACAAGTTTGTACAAAAAAGCAGGCT
  • 3′ sequencing primer ACCACTTTGTACAAGAAAGCTGGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the backbone sequence is from a non Gateway pCAG vector and may be missing a few features. These sequencing mismatches do not affect plasmid function. Please refer to Addgene's restriction digest for accurate representation of the plasmid size.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-Brainbow3.0 was a gift from Joshua Sanes (Addgene plasmid # 45176 ; http://n2t.net/addgene:45176 ; RRID:Addgene_45176)
  • For your References section:

    Improved tools for the Brainbow toolbox. Cai D, Cohen KB, Luo T, Lichtman JW, Sanes JR. Nat Methods. 2013 May 5;10(6):540-7. doi: 10.1038/nmeth.2450. Epub 2013 May 5. 10.1038/nmeth.2450 PubMed 23817127