-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC18
- Total vector size (bp) 3400
-
Vector typelinearized for transgenic mouse injection
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepThy1-Brainbow3.0
-
Speciesjelly fish and coral fluorescent proteins
-
Insert Size (bp)3400
- Promoter Thy1
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer attB_for
- 3′ sequencing primer GACTTGGGGAGGGAGTCAGCTGACC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycloned by Kim Cohen and Dawen Cai
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pThy1-Brainbow3.0 was a gift from Joshua Sanes (Addgene plasmid # 45177 ; http://n2t.net/addgene:45177 ; RRID:Addgene_45177) -
For your References section:
Improved tools for the Brainbow toolbox. Cai D, Cohen KB, Luo T, Lichtman JW, Sanes JR. Nat Methods. 2013 May 5;10(6):540-7. doi: 10.1038/nmeth.2450. Epub 2013 May 5. 10.1038/nmeth.2450 PubMed 23817127