-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45381 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUSE
- Total vector size (bp) 8612
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSrc-YF-UniRapR-mCerulean-myc
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2984
-
Mutationchanged mSrc Tyrosine 529 to Phenylalanine
- Promoter CMV
-
Tags
/ Fusion Proteins
- mCerulean (C terminal on insert)
- Myc (C terminal on insert)
- Myr (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUSE-Src-YF-UniRapR-mCerulean-myc was a gift from Klaus Hahn (Addgene plasmid # 45381 ; http://n2t.net/addgene:45381 ; RRID:Addgene_45381) -
For your References section:
Rational design of a ligand-controlled protein conformational switch. Dagliyan O, Shirvanyants D, Karginov AV, Ding F, Fee L, Chandrasekaran SN, Freisinger CM, Smolen GA, Huttenlocher A, Hahn KM, Dokholyan NV. Proc Natl Acad Sci U S A. 2013 Apr 23;110(17):6800-4. doi: 10.1073/pnas.1218319110. Epub 2013 Apr 8. 10.1073/pnas.1218319110 PubMed 23569285