Skip to main content

pUSE-Src-YF-UniRapR-mCerulean-myc
(Plasmid #45381)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45381 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUSE
  • Total vector size (bp) 8612
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Src-YF-UniRapR-mCerulean-myc
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2984
  • Mutation
    changed mSrc Tyrosine 529 to Phenylalanine
  • Promoter CMV
  • Tags / Fusion Proteins
    • mCerulean (C terminal on insert)
    • Myc (C terminal on insert)
    • Myr (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUSE-Src-YF-UniRapR-mCerulean-myc was a gift from Klaus Hahn (Addgene plasmid # 45381 ; http://n2t.net/addgene:45381 ; RRID:Addgene_45381)
  • For your References section:

    Rational design of a ligand-controlled protein conformational switch. Dagliyan O, Shirvanyants D, Karginov AV, Ding F, Fee L, Chandrasekaran SN, Freisinger CM, Smolen GA, Huttenlocher A, Hahn KM, Dokholyan NV. Proc Natl Acad Sci U S A. 2013 Apr 23;110(17):6800-4. doi: 10.1073/pnas.1218319110. Epub 2013 Apr 8. 10.1073/pnas.1218319110 PubMed 23569285