-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45447 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCI
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4006
- Total vector size (bp) 9695
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Growth instructionsNote: This plasmid causes extremely slow growth. The depositing lab notes that growth times longer than the standard growth period may be required.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNR2B
-
Alt nameNMDAR2B
-
Alt nameGrin2b
-
Alt nameGluN2B
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)5700
-
MutationEGFP inserted after the predicted signal peptide cleavage site (after amino acid residue 31)
-
GenBank ID
-
Entrez GeneGrin2b (a.k.a. GluN2B)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer T7; chim-int-F (TCTTACTGACATCCACTTTGCC)
- 3′ sequencing primer EBV-rev (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byRat NMDA receptor genes originally cloned by Shigetada Nakanishi (PMID: 1834949)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene Next-generation sequencing identified a sequence discrepancy that results in a Met to Leu change at position 745 in the plasmid insert, relative to Genbank IDs NM_012574.1 and NP_036706.1. The plasmid is expected to function as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-EGFP-NR2b wt was a gift from Andres Barria & Robert Malinow (Addgene plasmid # 45447 ; http://n2t.net/addgene:45447 ; RRID:Addgene_45447) -
For your References section:
Subunit-specific NMDA receptor trafficking to synapses. Barria A, Malinow R. Neuron. 2002 Jul 18;35(2):345-53. 10.1016/S0896-6273(02)00776-6 PubMed 12160751