BB-NIC-II-HisN-TET12
(Plasmid
#45496)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneBB-NIC-II-HisN
- Backbone size w/o insert (bp) 2288
- Total vector size (bp) 3629
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTET12
-
SpeciesSynthetic
-
Insert Size (bp)1386
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHistidine tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NgoMIV (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer cattaacctataaaaataggcgtatcacg
- 3′ sequencing primer CTTTGAGTGAGCTGATACCGCTCGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BB-NIC-II-HisN-TET12 was a gift from Roman Jerala (Addgene plasmid # 45496 ; http://n2t.net/addgene:45496 ; RRID:Addgene_45496) -
For your References section:
Design of a single-chain polypeptide tetrahedron assembled from coiled-coil segments. Gradisar H, Bozic S, Doles T, Vengust D, Hafner-Bratkovic I, Mertelj A, Webb B, Sali A, Klavzar S, Jerala R. Nat Chem Biol. 2013 Apr 28. doi: 10.1038/nchembio.1248. 10.1038/nchembio.1248 PubMed 23624438